View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5222_low_7 (Length: 266)
Name: NF5222_low_7
Description: NF5222
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5222_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 241; Significance: 1e-133; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 1 - 253
Target Start/End: Original strand, 9800233 - 9800485
Alignment:
| Q |
1 |
tactttttcttggcttctggggtacctcttttaggttcttcatctgccattgcaacaccagcaaaagtggaaacagcagcagctgctgcagcaaacatca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9800233 |
tactttttcttggcttctggggtacctcttttaggttcttcatctgccattgcaacaccagcaaaagtggaaacagcagcagctgctgcagcaaacatca |
9800332 |
T |
|
| Q |
101 |
agtctctccttccattgctgccctctttggtgttgtcatatctgatcatcttttccccttcaactgctcggacagcattgacgacgacgagtctcctctg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
9800333 |
agtctctccttccattgctgccctctttgctgttgtcatatctgatcatcttttccccttcaactgctcggacagcattgacgacaacgagtctcctctg |
9800432 |
T |
|
| Q |
201 |
cgatgctacggatgactggttggttacagccgggaagccgaggattgaggatg |
253 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9800433 |
cgatgctacagatgactggttggttacagccgggaagccgaggattgaggatg |
9800485 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 1 - 169
Target Start/End: Original strand, 9801822 - 9801990
Alignment:
| Q |
1 |
tactttttcttggcttctggggtacctcttttaggttcttcatctgccattgcaacaccagcaaaagtggaaacagcagcagctgctgcagcaaacatca |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||| | ||||| ||||||||||||||||| ||||||| || | |||||||||| ||||||||||||||||||| |
|
|
| T |
9801822 |
tactttttcttggcttctggagtacctcttcttggttcatcatctgccattgcaaccccagcaacagagcaaacagcagctgctgctgcagcaaacatca |
9801921 |
T |
|
| Q |
101 |
agtctctccttccattgctgccctctttggtgttgtcatatctgatcatcttttccccttcaactgctc |
169 |
Q |
| |
|
||||||| ||||||||||||||||| ||| | ||||||| ||| | ||||||||||||||||||||| |
|
|
| T |
9801922 |
agtctcttcttccattgctgccctccttgtcatcgtcatatttgaccgtcttttccccttcaactgctc |
9801990 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University