View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5222_low_9 (Length: 226)
Name: NF5222_low_9
Description: NF5222
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5222_low_9 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 17 - 217
Target Start/End: Original strand, 8941692 - 8941892
Alignment:
| Q |
17 |
agtttcgagggccaagcatttaatcgaggattggaggtttgctaacaagaagcagcagatgcgcgactgtcaacagcaaaatacagctgctgtcacactg |
116 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
8941692 |
agttgcgagggccaagcatttaatcgaggattggaggtttgctaacaagaagcagcagatgcacgactgtcaacagcaaaacacagctgctgtcacactg |
8941791 |
T |
|
| Q |
117 |
ccatatgcacagcagaatacggtttcaaggccgggggtatgtagatggcagagaccggcacgcgaaaggtttaagtgtaacattgatgcatattcttcga |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| || ||||| |
|
|
| T |
8941792 |
ccatatgcacagcagaatacggtttcaaggccaggggtatgtagatggcagagaccggcacgcggaaggtttaagtgtaacattgatgcatctttttcga |
8941891 |
T |
|
| Q |
217 |
c |
217 |
Q |
| |
|
| |
|
|
| T |
8941892 |
c |
8941892 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University