View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5224-Insertion-6 (Length: 203)
Name: NF5224-Insertion-6
Description: NF5224
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5224-Insertion-6 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 179; Significance: 8e-97; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 179; E-Value: 8e-97
Query Start/End: Original strand, 9 - 203
Target Start/End: Original strand, 46957959 - 46958153
Alignment:
| Q |
9 |
aaaacaccataagaacattgtctttgttcattttgatgatgaaccctcattgcaaaccaaatttgtcactcaattcaactatgttttatttggggatttg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
46957959 |
aaaacaccataagaacattgtctttgttcattttgatgatgaaccctcattgcaaaccaaatttgtcacttaattcaactatgttttatttgaggatttg |
46958058 |
T |
 |
| Q |
109 |
ggtcttgtctcaaatataggagtgaccttaaaaagataaagtagacagtacaatacaacgaattagaaacatgatttggacttcacaaatcataa |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46958059 |
ggtcttgtctcaaatataggagtgaccttaaaaagatcaagtcgacagtacaatacaacgaattagaaacatgatttggacttcacaaatcataa |
46958153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University