View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5224-Insertion-7 (Length: 133)
Name: NF5224-Insertion-7
Description: NF5224
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5224-Insertion-7 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 120; Significance: 2e-62; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 120; E-Value: 2e-62
Query Start/End: Original strand, 6 - 133
Target Start/End: Complemental strand, 38721491 - 38721364
Alignment:
| Q |
6 |
caccaatcattaccaattgtwtcttatgtggcaaccctttaccacattttgtatgttttttcacacatgcaccacacaacactactcttctagctaactc |
105 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
38721491 |
caccaatcattaccaattgtttcttatgtggcaaccctttaccacattttgtatgttttttcacacatgcaccacgcaacactactcttctagctaactc |
38721392 |
T |
|
| Q |
106 |
atctagtatcacacgctctgcatsattt |
133 |
Q |
| |
|
||||||||||||||||||||||| |||| |
|
|
| T |
38721391 |
atctagtatcacacgctctgcatcattt |
38721364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University