View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5224-Insertion-8 (Length: 121)
Name: NF5224-Insertion-8
Description: NF5224
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5224-Insertion-8 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 105; Significance: 7e-53; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 105; E-Value: 7e-53
Query Start/End: Original strand, 9 - 121
Target Start/End: Original strand, 4855458 - 4855570
Alignment:
| Q |
9 |
atctagtctcatcaaaattacattatttatctgtcctcttatcttctgcatcttagtcaagaagaaccaaaataccatactcttgggttgcgaaggtagc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4855458 |
atctagtctcatcaaaattacattatttctgtgtcctcttatcttctgcatcttagtcaagaagaaccaaaataccatactcttgggttgcgaaggtagc |
4855557 |
T |
|
| Q |
109 |
aaagaaccaatca |
121 |
Q |
| |
|
||||||||||||| |
|
|
| T |
4855558 |
aaagaaccaatca |
4855570 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University