View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5224_high_18 (Length: 312)
Name: NF5224_high_18
Description: NF5224
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5224_high_18 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 1 - 306
Target Start/End: Original strand, 44798845 - 44799150
Alignment:
| Q |
1 |
gattcttactttgcggttgaatttgatacaagttttgatccttctcttggtgacattaatggaaaccacgttggtattgatcttggcagtgttgtttctt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44798845 |
gattcttactttgcggttgaatttgatacgagttttgatccttctcttggtgacattaatggaaaccacgttggtattgatcttggcagtgttgtttctt |
44798944 |
T |
|
| Q |
101 |
ttgcttctgctgatcttctttcacgtcggattgatttgaaaagtgggaaaatcatcaatgcatggattgagtatagagatgatatgaaaatggttcgtgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44798945 |
ttgcttctgctgatcttctttcacgtcggattgatttgaaaagtgggaaaatcatcaatgcatggattgagtatagagatgatatgaaaatggttcgtgt |
44799044 |
T |
|
| Q |
201 |
ttgggttagttactcttcaactagacctccaacaccaattattgcttcattcattgatctttctgagagatttaaagagtttatgcatgttggtttctct |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44799045 |
ttgggttagttactcttcaactagacctccaacaccaattattgcttcattcattgatctttctgagagatttaaagagtttatgcatgttggtttctct |
44799144 |
T |
|
| Q |
301 |
gcttct |
306 |
Q |
| |
|
|||||| |
|
|
| T |
44799145 |
gcttct |
44799150 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University