View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5225_high_17 (Length: 290)
Name: NF5225_high_17
Description: NF5225
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5225_high_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 106; Significance: 4e-53; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 17 - 122
Target Start/End: Complemental strand, 41759392 - 41759287
Alignment:
| Q |
17 |
aagaaaaacatgattgaaaggggatatatccacttaaacttaagatggttagttatatccattgttgtacctacgcttttgattgaaaatgtgtctcagt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41759392 |
aagaaaaacatgattgaaaggggatatatccacttaaacttaagatggttagttatatccattgttgtacctacgcttttgattgaaaatgtgtctcagt |
41759293 |
T |
|
| Q |
117 |
gtctgg |
122 |
Q |
| |
|
|||||| |
|
|
| T |
41759292 |
gtctgg |
41759287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 120 - 193
Target Start/End: Complemental strand, 41759085 - 41759012
Alignment:
| Q |
120 |
tggacttcaaaacagggcataataggcttattagttcgtattactgttttttcctcttggtttgatttgattca |
193 |
Q |
| |
|
|||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41759085 |
tggacttcaaaatagggcataataggcttactagttcgtattactgttttttcctcttggtttgatttgattca |
41759012 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 217 - 273
Target Start/End: Complemental strand, 41758804 - 41758748
Alignment:
| Q |
217 |
tactcatatatgtacgtatgtatgtgttattacatgcagcttcctttctgaaaatta |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
41758804 |
tactcatatatgtacgtatgtatgtgttattaaatgcagcttcctttctgaaaatta |
41758748 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 234 - 272
Target Start/End: Complemental strand, 41754562 - 41754524
Alignment:
| Q |
234 |
atgtatgtgttattacatgcagcttcctttctgaaaatt |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
41754562 |
atgtatgtgttattacatgcagcttcctttttgaaaatt |
41754524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University