View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5225_high_18 (Length: 277)
Name: NF5225_high_18
Description: NF5225
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5225_high_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 242; Significance: 1e-134; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 20 - 261
Target Start/End: Original strand, 51222485 - 51222726
Alignment:
| Q |
20 |
atgcggaagtgttggtaatttgaaagtcacaaaatggtgatattttctctcgtaagttggtgaatattgaggacttagtgaagcatattaatatctcttc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51222485 |
atgcggaagtgttggtaatttgaaagtcacaaaatggtgatattttctctcgtaagttggtgaatattgaggacttagtgaagcatattaatatctcttc |
51222584 |
T |
 |
| Q |
120 |
tcggaggtggatttcaggatattcttgtactttttatgagtggttaatggacctctcttagtgcatgcagagataatcttttggttgattcttcatgatt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51222585 |
tcggaggtggatttcaggatattcttgtactttttatgagtggttaatggacctctcttagtgcatgcagagataatcttttggttgattcttcatgatt |
51222684 |
T |
 |
| Q |
220 |
tttggttggatttatggttgattttgtcttttcattgttcat |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51222685 |
tttggttggatttatggttgattttgtcttttcattgttcat |
51222726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 224 - 257
Target Start/End: Original strand, 51222430 - 51222463
Alignment:
| Q |
224 |
gttggatttatggttgattttgtcttttcattgt |
257 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |
|
|
| T |
51222430 |
gttggatgtatggttgattttgtcttttcattgt |
51222463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University