View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5225_high_9 (Length: 381)
Name: NF5225_high_9
Description: NF5225
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5225_high_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 62 - 359
Target Start/End: Original strand, 37768934 - 37769234
Alignment:
| Q |
62 |
cgatcgttgttactttgagcaatttacgagatctaaatgtttgaattcgatttatggagttttaggttttgatactatgcgatcttcatgggctgatttg |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37768934 |
cgatcgttgttactttgagcaatttacgagatctaaatgtttgaattcgatttatggagttttaggttttgatactatgcgatcttcatgggctgatttg |
37769033 |
T |
|
| Q |
162 |
gctgcaaattccgcggccgagaatgcaccaacaccaccacctt---nnnnnnnnnnnnnnnnnaacaatgctgccaacactcgtcctgtttacgttcctc |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37769034 |
gctgcaaattccgcggccgagaatgcaccaacaccaccaccttctgctgctgctgctgttgctaacaatgctgccaacactcgtcctgtttacgttcctc |
37769133 |
T |
|
| Q |
259 |
ctcatctaaggaaccgtggaccttcagcacctgcaccagcagcacctgctttcgacaactccggatcgcgttgggcacctccgcctaggaacgattatcg |
358 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
37769134 |
ctcatctaaggaaccgtggaccttcagcacctgcaccagcagcacctgctttcgataactccggatcgcgttgggcacctccccctaggaacgattatcg |
37769233 |
T |
|
| Q |
359 |
c |
359 |
Q |
| |
|
| |
|
|
| T |
37769234 |
c |
37769234 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University