View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5225_low_18 (Length: 277)

Name: NF5225_low_18
Description: NF5225
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5225_low_18
NF5225_low_18
[»] chr3 (2 HSPs)
chr3 (20-261)||(51222485-51222726)
chr3 (224-257)||(51222430-51222463)


Alignment Details
Target: chr3 (Bit Score: 242; Significance: 1e-134; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 20 - 261
Target Start/End: Original strand, 51222485 - 51222726
Alignment:
20 atgcggaagtgttggtaatttgaaagtcacaaaatggtgatattttctctcgtaagttggtgaatattgaggacttagtgaagcatattaatatctcttc 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51222485 atgcggaagtgttggtaatttgaaagtcacaaaatggtgatattttctctcgtaagttggtgaatattgaggacttagtgaagcatattaatatctcttc 51222584  T
120 tcggaggtggatttcaggatattcttgtactttttatgagtggttaatggacctctcttagtgcatgcagagataatcttttggttgattcttcatgatt 219  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51222585 tcggaggtggatttcaggatattcttgtactttttatgagtggttaatggacctctcttagtgcatgcagagataatcttttggttgattcttcatgatt 51222684  T
220 tttggttggatttatggttgattttgtcttttcattgttcat 261  Q
    ||||||||||||||||||||||||||||||||||||||||||    
51222685 tttggttggatttatggttgattttgtcttttcattgttcat 51222726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 224 - 257
Target Start/End: Original strand, 51222430 - 51222463
Alignment:
224 gttggatttatggttgattttgtcttttcattgt 257  Q
    ||||||| ||||||||||||||||||||||||||    
51222430 gttggatgtatggttgattttgtcttttcattgt 51222463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University