View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5225_low_23 (Length: 245)
Name: NF5225_low_23
Description: NF5225
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5225_low_23 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 189
Target Start/End: Complemental strand, 39726137 - 39725949
Alignment:
| Q |
1 |
ctagagactgtgaacagaaaatgttagttgtcaccaatgtttccttgtagagtttggaaaataaattatgaaaatggtcaatggtgtgaatggcaattaa |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39726137 |
ctagagactgtgaacagaaaatgttggttgtcaccaatgtttccttgtagagtttggaaaataaattatgaaaatggtcaatggtgtgaatggcaattaa |
39726038 |
T |
|
| Q |
101 |
gaaagcatagtaaaaatttagaagatgagataaatgatttagtgtaacggcaattcaaagaatcttcggacgatattcttttgtctaca |
189 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
39726037 |
gagagcatagtaaaaatttagaagatgagataaattatttagtgtaacggcaatacaaagaatcttcggacgatattcttttgtctaca |
39725949 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University