View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5226-Insertion-6 (Length: 125)
Name: NF5226-Insertion-6
Description: NF5226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5226-Insertion-6 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 115; Significance: 7e-59; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 115; E-Value: 7e-59
Query Start/End: Original strand, 7 - 125
Target Start/End: Original strand, 42448080 - 42448198
Alignment:
| Q |
7 |
atctttgccctcgcatagaacatcaaactgctcaaagtcgtcactcttcactcactccaaaaatgatgattggggggctactgttctggaatgatcaaaa |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
42448080 |
atctttgccctcgcatagaacatcaaactgctcaaagtcgtcactcttcactcactccaaaaatgatgattggggggctactgttctggaatgttcaaaa |
42448179 |
T |
|
| Q |
107 |
gatgctcacaatccaatgc |
125 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
42448180 |
gatgctcacaatccaatgc |
42448198 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 7 - 60
Target Start/End: Original strand, 18035680 - 18035733
Alignment:
| Q |
7 |
atctttgccctcgcatagaacatcaaactgctcaaagtcgtcactcttcactca |
60 |
Q |
| |
|
|||||| |||||||||| ||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
18035680 |
atcttttccctcgcataaaacatcaaacttctcaaagtcaacactcttcactca |
18035733 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.0000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.0000000006
Query Start/End: Original strand, 12 - 56
Target Start/End: Complemental strand, 12694319 - 12694275
Alignment:
| Q |
12 |
tgccctcgcatagaacatcaaactgctcaaagtcgtcactcttca |
56 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
12694319 |
tgccctcgcatagaacatcaaactgctagaagtcatcactcttca |
12694275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University