View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5226_high_12 (Length: 278)
Name: NF5226_high_12
Description: NF5226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5226_high_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 158; Significance: 4e-84; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 76 - 273
Target Start/End: Complemental strand, 1172714 - 1172518
Alignment:
| Q |
76 |
tgttcaattcttaatattaattttaatatcaagttgatttgctaatccactcttgtaataggttgtcattaattggaccagtttttagggttacacttta |
175 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||| | | |||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
1172714 |
tgttcgattcttaatattaattttaatatcaagttgatttgctaatccattgt-gtaataggttgtcattaattggaccagtttttaggggtacacttta |
1172616 |
T |
|
| Q |
176 |
gattctcaattttcgtctcaccctttatataactccctttcctaaaccctaaaccctaccaatgactaaagttcaaaatctattttgcaggttctgtg |
273 |
Q |
| |
|
|| |||||||| || ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1172615 |
gactctcaattctcatctcaccctttatataactccctttccaaaaccctaaaccctaccaatgactaaagttcaaaatctattttgcaggttctgtg |
1172518 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 103 - 219
Target Start/End: Complemental strand, 1181907 - 1181795
Alignment:
| Q |
103 |
atcaagttgatttgctaatccactcttgtaataggttgtcattaattggaccagtttttagggttacactttagattctcaattttcgtctcacccttta |
202 |
Q |
| |
|
|||||||||||||||||||||| | | ||||||||| |||||| ||||| |||||||||| | ||| ||||||||||| || || ||||||| |||| |
|
|
| T |
1181907 |
atcaagttgatttgctaatccattgtagtaataggtcgtcatt----ggacccgtttttagggctccacattagattctcagttctcttctcacctttta |
1181812 |
T |
|
| Q |
203 |
tataactccctttccta |
219 |
Q |
| |
|
|||| |||||||||||| |
|
|
| T |
1181811 |
tatatctccctttccta |
1181795 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University