View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5226_high_16 (Length: 256)
Name: NF5226_high_16
Description: NF5226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5226_high_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 150 - 237
Target Start/End: Complemental strand, 38721527 - 38721439
Alignment:
| Q |
150 |
gtccaaaacaaagatgacacataaaatttaaaagaagaagatatcagatgttgatgcaaattat-tttttcttaattgaaagttcgtcc |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||| | |||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
38721527 |
gtccaaaacaaagatgacacataaaatttaaaagaagaatatatcagatatcgatgcaaattatcttttttttaattgaaagttcgtcc |
38721439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 18 - 81
Target Start/End: Complemental strand, 38721661 - 38721597
Alignment:
| Q |
18 |
cacagactactacata-acgggtcatatcttaagctaaataaagatgacggttgtcctagacccc |
81 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38721661 |
cacagactactacatatacggatcatatcttaagctaaataaagatgacggttgtcctagacccc |
38721597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University