View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5226_high_8 (Length: 361)
Name: NF5226_high_8
Description: NF5226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5226_high_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 130; Significance: 3e-67; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 130; E-Value: 3e-67
Query Start/End: Original strand, 1 - 147
Target Start/End: Complemental strand, 34062696 - 34062548
Alignment:
| Q |
1 |
acaagcaagtttcagagagattcgtgttttgtgagaaactctctcaatgcaacaagaattttgcatttgatcattgatgagattgagagagattcgtg-- |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34062696 |
acaagcaagtttcagagagattcgtgttttgtgagaaaccctctcaatgcaacaagaattttgcatttgatcattgatgagattgagagagattcgtgtg |
34062597 |
T |
 |
| Q |
99 |
tgtggtttcataatcttttataccattcaacaatgaacatagtcttaat |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
34062596 |
tgtggtttcataatcttttataccattcaacaatgaacctagtcttaat |
34062548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 218 - 289
Target Start/End: Complemental strand, 34062482 - 34062411
Alignment:
| Q |
218 |
gaaaatcactaaatggctagacatcttatcgctatttctctttattctgtgttaaagcttttccagcactat |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
34062482 |
gaaaatcactaaatggctagacatcttatcgctatttctctttattctgtgttaaagcttttccaacactat |
34062411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 307 - 342
Target Start/End: Complemental strand, 34062403 - 34062368
Alignment:
| Q |
307 |
tcacccacagaatatgccttgctacactatgtggct |
342 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |
|
|
| T |
34062403 |
tcacacacagaatatgccttgctacactatgtggct |
34062368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University