View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5226_low_14 (Length: 273)
Name: NF5226_low_14
Description: NF5226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5226_low_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 18 - 258
Target Start/End: Original strand, 24245451 - 24245691
Alignment:
| Q |
18 |
ccaaaaatgccacgaaaatcaaagaagaaaagggtgtgtaagaagaaactagggtttattcagcaacaacaacaacaagaatggtggaagaaagaagaag |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24245451 |
ccaaaaatgccacgaaaatcaaagaagaaaagggtctgtaagaagaaactagggtttattcagcaacaacaacaacaagaatggtggaagaaagaagaag |
24245550 |
T |
|
| Q |
118 |
atgaaccaaaatgggtcacacattattgcagtgatcatcaaatactgttagtgggtgatggcgatttctctttctcactttcacttgcaaaagcttttgg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| || ||||||||||||||||| |
|
|
| T |
24245551 |
atgaaccaaaatgggtcacacattattgcagtgatcatcaaatactgttagtgggtgatggcgatttctcattctcactctctcttgcaaaagcttttgg |
24245650 |
T |
|
| Q |
218 |
ttctgcttcaaatatcgttgcttcttcatttgacacctatg |
258 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
24245651 |
ttctgcttcaaatatcgttgcttcttcacttgacacctatg |
24245691 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University