View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5226_low_15 (Length: 261)
Name: NF5226_low_15
Description: NF5226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5226_low_15 |
 |  |
|
| [»] scaffold0029 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 17 - 250
Target Start/End: Original strand, 35412391 - 35412624
Alignment:
| Q |
17 |
agtacttgtatactggtctgcatttatgcagagtgcaatgaatactgaccagacttagtaggaggacggccagtaagacagcgtgtgggatgaggattgt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35412391 |
agtacttgtatactggtctgcatttatgcagagtgcaatgaatactgaccagacttagtaggaggacggccagtatgacagcgtgtgggatgaggattgt |
35412490 |
T |
 |
| Q |
117 |
cttgaccacctagagttggccttgcataatcatttcctttgtctggatcacctaaatcattgtacacatcgtaatcataaatcctgtcacatgatgattt |
216 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
35412491 |
cttgaccaccaagagttggccttgcataatcatttcctttgtctggatcacctaaatcattgtacacatcgtactcataaatcctgtcccatgatgattt |
35412590 |
T |
 |
| Q |
217 |
catgcgtcctttcccactaccatcatcacctctc |
250 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |
|
|
| T |
35412591 |
catgcgtcctttcccactaccataatcacctctc |
35412624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0029 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0029
Description:
Target: scaffold0029; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 17 - 58
Target Start/End: Complemental strand, 53351 - 53310
Alignment:
| Q |
17 |
agtacttgtatactggtctgcatttatgcagagtgcaatgaa |
58 |
Q |
| |
|
|||||||||||||||||||||||||||| || |||||||||| |
|
|
| T |
53351 |
agtacttgtatactggtctgcatttatgtagtgtgcaatgaa |
53310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 153 - 201
Target Start/End: Original strand, 6371289 - 6371337
Alignment:
| Q |
153 |
ctttgtctggatcacctaaatcattgtacacatcgtaatcataaatcct |
201 |
Q |
| |
|
|||||||||| ||||| ||||||||||| |||||||| ||||| ||||| |
|
|
| T |
6371289 |
ctttgtctggttcacccaaatcattgtagacatcgtagtcatagatcct |
6371337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University