View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5226_low_18 (Length: 234)
Name: NF5226_low_18
Description: NF5226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5226_low_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 15 - 225
Target Start/End: Complemental strand, 40942635 - 40942425
Alignment:
| Q |
15 |
taatagaccaacataagtgggaagtatctgcatgattgatatagataataaaaccaagagcttgtcaaacttgtcacactgcaaatcgaaagtgcatcaa |
114 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||| ||||||||||||| ||||||| |
|
|
| T |
40942635 |
taatagaccaccataagtgggaagtatctgcatgattgattgagataataaaaccaagagcttgtctaacttgtcacattgcaaatcgaaagggcatcaa |
40942536 |
T |
 |
| Q |
115 |
gccattnnnnnnntaaactgcactaagaggatcaaagtatgctatcctttgctgtggttttttgggtgtcaaggttgcaagactattttaaagggaggtg |
214 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
40942535 |
gccattaacaaaataaactgcactaagaggatcaaagtatgatatcctttgctgtggttttttgggtgtcaagattgcaagactattttaaagggaggtg |
40942436 |
T |
 |
| Q |
215 |
atgggtgatga |
225 |
Q |
| |
|
||||||||||| |
|
|
| T |
40942435 |
atgggtgatga |
40942425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University