View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5227-Insertion-3 (Length: 118)
Name: NF5227-Insertion-3
Description: NF5227
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5227-Insertion-3 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 110; Significance: 7e-56; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 110; E-Value: 7e-56
Query Start/End: Original strand, 5 - 118
Target Start/End: Complemental strand, 17814624 - 17814511
Alignment:
| Q |
5 |
acaacttactcaacaagttaccatccctttgaaagataatcaagacaaactattgcgaacacttctttgacttaatcaagacaatatggtttgcaagaaa |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17814624 |
acaacttactcaacaagttaccatccctttgaaatataatcaagacaaactattgcgaacacttctttgacttaatcaagacaatatggtttgcaagaaa |
17814525 |
T |
 |
| Q |
105 |
ccaagcaagattta |
118 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
17814524 |
ccaagcaagattta |
17814511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University