View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5227_high_3 (Length: 261)
Name: NF5227_high_3
Description: NF5227
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5227_high_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 249
Target Start/End: Original strand, 10517632 - 10517881
Alignment:
| Q |
1 |
tatcattttcatatctatgtgtgaaatttgattgcaggtatttatttctnnnnnnntttgatttgaaattacataccaaaagtatcctcttggtcttata |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10517632 |
tatcattttcatatctatgtgtgaaatttgattgcaggtatttatttctaaaaaaatttgatttgaaattacataccaaaagtatcctcttggtcttata |
10517731 |
T |
 |
| Q |
101 |
ttataaaagtcattttagatgaaaaactcatcctgttttatagtattattgttttacaaattatcatttttctagtatactcaatgttatgattgatgta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10517732 |
ttataaaagtcattttagatgaaaaactcatcctgttttatagtattattgttttacaaattatcatttttctagtatactcaatgttatgattgatgta |
10517831 |
T |
 |
| Q |
201 |
-nnnnnnnatcaatgaaattttttcttctcaattggagtttaattagtat |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10517832 |
ttttttttatcaatgaaattttttcttctcaattggagtttaattagtat |
10517881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University