View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5228-Insertion-17 (Length: 113)
Name: NF5228-Insertion-17
Description: NF5228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5228-Insertion-17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 68; Significance: 7e-31; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 68; E-Value: 7e-31
Query Start/End: Original strand, 10 - 89
Target Start/End: Complemental strand, 47310455 - 47310376
Alignment:
| Q |
10 |
atctccaacaagtgacgaatttgatttaccgacgctcaacccaagcgactatctaacttacttgacttcatgatttgctc |
89 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
47310455 |
atctccaacaagtgacgaatttgatttaccgacgctcgacccaagcgactatgtaacttacttgacttcatgatctgctc |
47310376 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 28; Significance: 0.0000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 28; E-Value: 0.0000005
Query Start/End: Original strand, 8 - 63
Target Start/End: Original strand, 31338362 - 31338417
Alignment:
| Q |
8 |
ccatctccaacaagtgacgaatttgatttaccgacgctcaacccaagcgactatct |
63 |
Q |
| |
|
|||||||||| ||| ||||||||| ||| || |||||| |||||||||||||||| |
|
|
| T |
31338362 |
ccatctccaataagcgacgaattttattaactaacgctctacccaagcgactatct |
31338417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University