View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5229-Insertion-13 (Length: 355)
Name: NF5229-Insertion-13
Description: NF5229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5229-Insertion-13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 8 - 132
Target Start/End: Complemental strand, 36743018 - 36742894
Alignment:
| Q |
8 |
gggctttcttgaatgaagaacaaaactcaatgttgaggaaattgcttattaggcccctttaattgctcacaagcccctcaaaatccagatgcaaaacgta |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
36743018 |
gggctttcttgaatgaagaacaaaactcaatgttgaggaaattacttattaggcccctttaattgctcataagcccctcaaaatccagatgcaaaacgta |
36742919 |
T |
|
| Q |
108 |
taacacaaaatagaaggagaatgtg |
132 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
36742918 |
taacacaaaatagaaggagaatgtg |
36742894 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 231 - 355
Target Start/End: Complemental strand, 36742795 - 36742671
Alignment:
| Q |
231 |
taaatgacataaaatttgttcgtatttcattcaacatttcataatgacatttgttgtggacttacgatatacatcattcatgaaaaataaaataaaagaa |
330 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
36742795 |
taaatgacataaaatttgttcgtatttcattcaacatttcataatgacatttattgtggacttacgatatacatcattcatgagaaataaaataaaagaa |
36742696 |
T |
|
| Q |
331 |
catataaaatcatcggaacgcctcc |
355 |
Q |
| |
|
||||||| ||||| |||||||||| |
|
|
| T |
36742695 |
tatataaagtcatcagaacgcctcc |
36742671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 30 - 90
Target Start/End: Original strand, 8572129 - 8572189
Alignment:
| Q |
30 |
aaactcaatgttgaggaaattgcttattaggcccctttaattgctcacaagcccctcaaaa |
90 |
Q |
| |
|
|||||||||||||| |||||| | |||||||||||| || |||||||| |||||| |||| |
|
|
| T |
8572129 |
aaactcaatgttgaaaaaattgatcattaggccccttaaaatgctcacatgcccctaaaaa |
8572189 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University