View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5229-Insertion-14 (Length: 335)
Name: NF5229-Insertion-14
Description: NF5229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5229-Insertion-14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 8 - 324
Target Start/End: Complemental strand, 10343963 - 10343643
Alignment:
| Q |
8 |
gggataatcataacgccgtgtaaatgcattttccgatactttcacattctcctaattcatagtaaattcacaatatcattaacaataatnnnnnnn-tta |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
10343963 |
gggataatcataacgccgtgtaaatgcattttccgatactttcacattctcctaattcatagtaaattcacaatatcattaacaataataaaaaaaatta |
10343864 |
T |
|
| Q |
107 |
atcctcaattacactctaaacgatcaatttcacagcgtagttatggggaatgcttacagtgagaatgtcttggtaattggtgtcagttgtaacaagacca |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10343863 |
atcctcaattacactctaaacgatcaatttcacagcgtagttatggggaatgcttacagtgagaatgtcttggtaattggtgtcagttgtaacaagacca |
10343764 |
T |
|
| Q |
207 |
cgttgatacacattaaattcgttgcttttcgaaggagaaga-tgccttaaccggtaagcggcgacgacggcgatgaccgatgatatgatgaagaagg-aa |
304 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
10343763 |
cgttgatacacattaaattcgttgcttttcgaaggagaagattgtcttaaccggtaagcggcgacgacggcgatgaccgatgatatgatgaagaaggcaa |
10343664 |
T |
|
| Q |
305 |
cgattttgatgg-accggaag |
324 |
Q |
| |
|
|||||||||||| |||||||| |
|
|
| T |
10343663 |
cgattttgatggcaccggaag |
10343643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University