View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5229-Insertion-20 (Length: 133)
Name: NF5229-Insertion-20
Description: NF5229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5229-Insertion-20 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 104; Significance: 3e-52; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 104; E-Value: 3e-52
Query Start/End: Original strand, 30 - 133
Target Start/End: Original strand, 43624847 - 43624950
Alignment:
| Q |
30 |
gcttttgtattgatgtgtgtgaaatgaagaatttcatgctatgaaaagggaaacaattatacaacctaaagaaattggagcttgtagttccatgtgtcca |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43624847 |
gcttttgtattgatgtgtgtgaaatgaagaatttcatgctatgaaaagggaaacaattatacaacctaaagaaattggagcttgtagttccatgtgtcca |
43624946 |
T |
|
| Q |
130 |
cctc |
133 |
Q |
| |
|
|||| |
|
|
| T |
43624947 |
cctc |
43624950 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 55; E-Value: 5e-23
Query Start/End: Original strand, 7 - 109
Target Start/End: Original strand, 26413080 - 26413187
Alignment:
| Q |
7 |
atgagattcaaaaaattcaaagagcttttgtatt----gatgtgtgtgaaatgaagaa-tttcatgctatgaaaagggaaacaattatacaacctaaaga |
101 |
Q |
| |
|
|||||||||||| ||| || ||||||||||||| |||||| ||||| |||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26413080 |
atgagattcaaacaatacatagagcttttgtatgaggagatgtggatgaaaagaagaagtttcatgctatgaaaagggaaacaattatacaacctaaaga |
26413179 |
T |
|
| Q |
102 |
aattggag |
109 |
Q |
| |
|
|||||||| |
|
|
| T |
26413180 |
aattggag |
26413187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University