View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5229-Insertion-23 (Length: 209)
Name: NF5229-Insertion-23
Description: NF5229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5229-Insertion-23 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 8 - 179
Target Start/End: Original strand, 2273544 - 2273715
Alignment:
| Q |
8 |
gcattgacaatatttgaatgagagctgtgcatcaatgcctttttgagcttcacataatcatcgtcattcattgcagctatctgcggtatatacataatca |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
2273544 |
gcattgacaatatttgaatgagagctgtgcatcaatgcctttttgagcttcacataatcatcgtcattcattgtagctatctgcagtatatacataatca |
2273643 |
T |
 |
| Q |
108 |
aacatgtgatcaaaactaagatagaaaataatttaaaataaactcttgttggcaccacctcacaatgcaaga |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2273644 |
aacatgtgatcaaaactaagatagaaaataatttaaaataaactcttgttggcaccacctcacaatgcaaga |
2273715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University