View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5229_high_29 (Length: 298)
Name: NF5229_high_29
Description: NF5229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5229_high_29 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 18 - 288
Target Start/End: Complemental strand, 6326532 - 6326263
Alignment:
| Q |
18 |
atatatgctaaggcgttgcttaaacaaatggccaccgtaaaacatattgtcgatatattgtctatactttttaatgttttggtatatctagccaaagatt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
6326532 |
atatatgctaaggcgttgcttaaacaaatggccaca-taaaacatattgtcgatatattgtctatactttttaatgttttggtatatctagccaacgatt |
6326434 |
T |
 |
| Q |
118 |
tcatgacattcgattattaaatggaatgggcaatattaaatatgtatatgtaaacatgtgcatacctttgtcagagttttttcttttgtcacacaatgta |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6326433 |
tcatgacattcgattattaaatggaatgggcaatattaaatatgtatatgtaaacatgtgcatacctttgtcagagttttttcttttgtcacacaatgta |
6326334 |
T |
 |
| Q |
218 |
aataagtaatattttgaaacttttggtattaaaatttatttttagttaactaacatgtgattttggtctct |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6326333 |
aataagtaatattttgaaacttttggtattaaaatttatttttagttaactaacatgtgattttggtctct |
6326263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University