View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5229_high_43 (Length: 244)
Name: NF5229_high_43
Description: NF5229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5229_high_43 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 19 - 237
Target Start/End: Original strand, 42678173 - 42678391
Alignment:
| Q |
19 |
aaatattgctgagagaannnnnnnnattgggtggttaacattctttctcatcgtttcttgctcagaatttcaacttgtacctgattcaagaccacaatga |
118 |
Q |
| |
|
||||||||||||||||| ||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42678173 |
aaatattgctgagagaattttttttattggtttgttaacattctttctcatcgtttcttgctcagaatttcaacttgtacctgattcaagaccacaatga |
42678272 |
T |
 |
| Q |
119 |
taatgatgaaggaagagcctagttcaaaaccaatcatgatccgtaaagtgtggggatacaatttgtcttgcgaattcaagctcattagtcagttaattgg |
218 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42678273 |
taatgatgaaggaagaccctggttcaaaaccaatcatgatccgtaaagtgtggggatacaatttgtcttgcgaattcaagctcattagtcagttaattgg |
42678372 |
T |
 |
| Q |
219 |
taaatacaatttcatctca |
237 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
42678373 |
taaatacaatttcatctca |
42678391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University