View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5229_high_45 (Length: 240)
Name: NF5229_high_45
Description: NF5229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5229_high_45 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 87; Significance: 8e-42; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 18 - 138
Target Start/End: Complemental strand, 34742402 - 34742289
Alignment:
| Q |
18 |
tctactttaagtggtttcaataaagtacacacttagctctcctgagtcccatgttgaaatcaacttttatgcttcgcgcattacaaaattttgttattct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
34742402 |
tctactttaagtggtttcaataaagtacacacttagctctcctgagtctcatgttgaaatcaa-------gtttcgcgcattacaaaattttgttattct |
34742310 |
T |
|
| Q |
118 |
ggttttacatcggataccatt |
138 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
34742309 |
ggttttacatcggataccatt |
34742289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 72 - 186
Target Start/End: Complemental strand, 34751525 - 34751411
Alignment:
| Q |
72 |
tgaaatcaacttttatgcttcgcgcattacaaaattttgttattctggttttacatcggataccattatgttagatgcacacagtttagcgtttgctgat |
171 |
Q |
| |
|
|||||| || ||||||||| ||||| || ||||||| ||||||||||||| || || ||||| ||| ||||||| ||||| ||| |||| ||||||||| |
|
|
| T |
34751525 |
tgaaattaagttttatgctacgcgccttgcaaaattctgttattctggttatatgtcagatacaattttgttagaggcacatagtgtagcatttgctgat |
34751426 |
T |
|
| Q |
172 |
attgttctgtatgat |
186 |
Q |
| |
|
|||| ||| |||||| |
|
|
| T |
34751425 |
attgctctatatgat |
34751411 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 67 - 120
Target Start/End: Complemental strand, 34746920 - 34746867
Alignment:
| Q |
67 |
catgttgaaatcaacttttatgcttcgcgcattacaaaattttgttattctggt |
120 |
Q |
| |
|
|||| |||||| || |||||||||||||||||| ||| ||||||||||| |||| |
|
|
| T |
34746920 |
catgctgaaattaagttttatgcttcgcgcattgcaacattttgttattatggt |
34746867 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University