View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5229_high_54 (Length: 238)
Name: NF5229_high_54
Description: NF5229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5229_high_54 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 10344270 - 10344505
Alignment:
| Q |
1 |
aattctaagaattggtgattgaaatgtgggactttatgcttttattatttttgttattgtaattttataacttgtagtatgaatgaaagaacactaatct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
10344270 |
aattctaagaattggtgattgaaatgtgagactttatgcttttattatttttgttattgtaattttataacttgtagtatgaatgaaagaacactaattt |
10344369 |
T |
|
| Q |
101 |
gtattttgtagtgcatgataatttactcctaattttgtacttgagcataaactgactcaaaaatttatattaacttataagtagtctttaacggctggtc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
10344370 |
gtattttgtagtgcatgataatttactcctaattttgtacttgagcataaactgactcaaaaatt--tattaacttataagtagtctttaacggctggtc |
10344467 |
T |
|
| Q |
201 |
tttttgaatgagttcgtgccagtggcaactgcaattct |
238 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
10344468 |
tttttgaatgagttcgtgtcagtggcaactgcaattct |
10344505 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University