View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5229_low_32 (Length: 293)
Name: NF5229_low_32
Description: NF5229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5229_low_32 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 20 - 279
Target Start/End: Original strand, 5688559 - 5688818
Alignment:
| Q |
20 |
tttgaatcataaaatatagtctcagannnnnnnncaaaataatgtttataagaaattttgtgagagtctttataatattttcnnnnnnntaaataaggtc |
119 |
Q |
| |
|
|||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
5688559 |
tttgaaccataaaatatagtctcagattttttttcaaaataatgtttataagaaattttgtgagagtctttataatattttcaaaaaaataaataaggtc |
5688658 |
T |
|
| Q |
120 |
ttacctttttaatcaacaactcatacatagggccgacttcatatagtatttttatagctcatacttgaaagaactttttggcctaacgcgataaaggttg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
5688659 |
ttacctttttaatcaacaactcatacatagggccgacttcatatagtatttttatagctcgtacttgaaagaactttttggcctaaagcgataaaggttg |
5688758 |
T |
|
| Q |
220 |
ttaaggccgatctgtttaaggttagataacccattttgagagctctacacatattctcat |
279 |
Q |
| |
|
||| ||||||||| ||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
5688759 |
ttagggccgatctctttaaggttagataacccattttgagagctctacacataatctcat |
5688818 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University