View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5229_low_36 (Length: 266)
Name: NF5229_low_36
Description: NF5229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5229_low_36 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 149; Significance: 9e-79; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 149; E-Value: 9e-79
Query Start/End: Original strand, 20 - 266
Target Start/End: Original strand, 9313940 - 9314195
Alignment:
| Q |
20 |
aatccttgccaacaaccatatctattgcaccctctacgtccttgnnnnnnnnnnnnnnnnnctttcttacaatcgaattatcaacttcatatgcaaacta |
119 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
9313940 |
aatccttgccaacaaccaaatctattgcaccctctacgtccttgttttgtttttattttttctttcttacaatcgaattatcaacttcatatacaaacta |
9314039 |
T |
|
| Q |
120 |
caacacccctagcctcggat---------aatgataagttctttaccacttactcacatccttccaacaccccattcagtaacactcgtttcttttttat |
210 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9314040 |
caacacgcctagcctcggatgacataaaaaatgataagttctttaccacttactcacatccttccaacaccccattcagtaacactcgtttcttttttat |
9314139 |
T |
|
| Q |
211 |
caccccagcccaccattggtgatagcaaacggagaacggggacccgatgcactagc |
266 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |||||||| ||||||||| |
|
|
| T |
9314140 |
caccccagcccaccattggtgatagcaatcggagaacagggacccggtgcactagc |
9314195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 140 - 238
Target Start/End: Original strand, 9289587 - 9289682
Alignment:
| Q |
140 |
aatgataagttctttaccacttactcacatccttccaacaccccattcagtaacactcgtttcttttttatcaccccagcccaccattggtgatagcaa |
238 |
Q |
| |
|
|||||||| |||||| |||| | ||||||||||||||| |||||||| | ||||| || ||||||||| ||||| |||||| ||||||||||||| |
|
|
| T |
9289587 |
aatgataacttctttgtcactgaatcacatccttccaactccccattcggcaacac---ttatttttttatcgccccaacccacctttggtgatagcaa |
9289682 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University