View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5229_low_37 (Length: 259)

Name: NF5229_low_37
Description: NF5229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5229_low_37
NF5229_low_37
[»] chr8 (2 HSPs)
chr8 (1-212)||(5381910-5382122)
chr8 (4-120)||(42744198-42744314)
[»] chr2 (1 HSPs)
chr2 (1-129)||(43071666-43071794)


Alignment Details
Target: chr8 (Bit Score: 201; Significance: 1e-110; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 5381910 - 5382122
Alignment:
1 cagaaaattgctgttggagctgctcgtgggttaaggtatcttcatgaagagtgcagagtaggttgtatcatccaccgtgacatgaggccaaacaatattc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5381910 cagaaaattgctgttggagctgctcgtgggttaaggtatcttcatgaagagtgcagagtaggttgtatcatccaccgtgacatgaggccaaacaatattc 5382009  T
101 tcataactcatgattttgaacctctggtaagttagttctctgccttctttttggcaataaaaaataccattacttcactattgcata-ttcatctgtcta 199  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
5382010 tcataactcatgattttgaacctctggtacgttagttctctgccttctttttggcaataaaaaataccattacttcactattgcatatttcatctgtcta 5382109  T
200 tatatctttcaat 212  Q
    |||||||||||||    
5382110 tatatctttcaat 5382122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 4 - 120
Target Start/End: Complemental strand, 42744314 - 42744198
Alignment:
4 aaaattgctgttggagctgctcgtgggttaaggtatcttcatgaagagtgcagagtaggttgtatcatccaccgtgacatgaggccaaacaatattctca 103  Q
    |||||||| |||||||| |||||||| || || |||||||||||||| |||||||| ||||| ||  | ||||||||  || |||| |||||||| |||     
42744314 aaaattgcggttggagcagctcgtggtttgagatatcttcatgaagaatgcagagttggttgcattgtacaccgtgatttgcggcctaacaatatcctcc 42744215  T
104 taactcatgattttgaa 120  Q
    | |||||||||||||||    
42744214 tcactcatgattttgaa 42744198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 129
Target Start/End: Complemental strand, 43071794 - 43071666
Alignment:
1 cagaaaattgctgttggagctgctcgtgggttaaggtatcttcatgaagagtgcagagtaggttgtatcatccaccgtgacatgaggccaaacaatattc 100  Q
    |||||||||||||| || ||||||||||| ||  | |||||||||||||||||||| || || || ||  | |||||||||||| |||| ||||| ||||    
43071794 cagaaaattgctgtcggggctgctcgtggattgcgatatcttcatgaagagtgcagggtgggatgcattgttcaccgtgacatgcggcctaacaacattc 43071695  T
101 tcataactcatgattttgaacctctggta 129  Q
    | || |||||||||||||| || ||||||    
43071694 ttatcactcatgattttgagccactggta 43071666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University