View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5229_low_44 (Length: 247)
Name: NF5229_low_44
Description: NF5229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5229_low_44 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 35801383 - 35801606
Alignment:
| Q |
1 |
attttaaattatattaaagaatgtcttcaaagcactcattagcattttctttagaattattgaaaacagattgagataaaaaatgttgctacttagaatg |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35801383 |
attttaaactatattaaagaatgtcttcaaagaactcattagcattttctttagaattattgaaaacagattgagataaaaaatgttgctacttagaatg |
35801482 |
T |
|
| Q |
101 |
atacaatgctatactatagtttaagcattgatatcctattaaaacatgtattaaattttaatcaatctcatccaaatgtgcatagcaaagatttcagtca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
35801483 |
atacaatgctatactatagtttaagcattgatatcctattaaaacatgtattaaattttaatcaatctcatccaaatgtgtatagcaaagatttcagtca |
35801582 |
T |
|
| Q |
201 |
ttttcgaaggggtttgcctatggg |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
35801583 |
ttttcgaaggggtttgcctatggg |
35801606 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 141 - 223
Target Start/End: Complemental strand, 54847963 - 54847881
Alignment:
| Q |
141 |
aaaacatgtattaaattttaatcaatctcatccaaatgtgcatagcaaagatttcagtcattttcgaaggggtttgcctatgg |
223 |
Q |
| |
|
||||| ||| || |||||||||||||||||| |||||||||||| ||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
54847963 |
aaaacttgttttgaattttaatcaatctcattcaaatgtgcatatcaaggatttcagtcattttcgaagggtattgcctatgg |
54847881 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University