View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5229_low_45 (Length: 246)
Name: NF5229_low_45
Description: NF5229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5229_low_45 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 72; Significance: 7e-33; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 88 - 223
Target Start/End: Original strand, 37401712 - 37401847
Alignment:
| Q |
88 |
ctatttaggttttgggtgtttcaattcattctgattttgattgacttaggtgnnnnnnnnnnnnnnnnnnnngatttgacttggattgaaattgaactca |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
37401712 |
ctatttaggttttgggtgtttcaattcattctgatattgattgacttaggtgttttttctctctttctttttgatttgacttggattgaaattgaactca |
37401811 |
T |
|
| Q |
188 |
agtatcatgtttttatagatcaatttttgaagatag |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
37401812 |
agtatcatgtttttatagatcaatttttgaagatag |
37401847 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 89 - 122
Target Start/End: Complemental strand, 42945557 - 42945524
Alignment:
| Q |
89 |
tatttaggttttgggtgtttcaattcattctgat |
122 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
42945557 |
tatttaggttttggctgtttcaattcattctgat |
42945524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University