View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5229_low_55 (Length: 238)
Name: NF5229_low_55
Description: NF5229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5229_low_55 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 131; Significance: 4e-68; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 49 - 223
Target Start/End: Complemental strand, 34636166 - 34635994
Alignment:
| Q |
49 |
gtgcgagcagttgtgacctccagaagaacatcaatcatctcnnnnnnnnncctgtgacttcttcacaaaactttggtttgatatttataattggctaggt |
148 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34636166 |
gtgcgagcagttgtgacctccagaagaacatcagtcatctcttttttt--cctgtgacttcttcacaaaactttggtttgatatttataattggctaggt |
34636069 |
T |
|
| Q |
149 |
tttgttaggttcatccgacatacatcatatatcacttacttcaatttggatcactaggtggctactcaaaaatat |
223 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
34636068 |
tttgttaggttcatccgacatacatcacatatcacttacttcaatttggatcacttggtggctactcaaaaatat |
34635994 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 34636239 - 34636188
Alignment:
| Q |
1 |
ctgttgcacaatcggataccatcaacaaataatttaatcaggagacgagtgc |
52 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
34636239 |
ctgttgcacaatcggataccaccaacaaataatttaatcaggagacgagtgc |
34636188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 120 - 220
Target Start/End: Complemental strand, 23536940 - 23536839
Alignment:
| Q |
120 |
tttggtttgatatttataattggctaggttttgtta-ggttcatccgacatacatcatatatcacttacttcaatttggatcactaggtggctactcaaa |
218 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||| |||| | || ||| | || | |||||| |||||||||||||||| |||| ||||||||||||| |
|
|
| T |
23536940 |
tttggtttgatatttagaattgactaggttttgttacggtttagcccacacatattacatatcatttacttcaatttggattactatgtggctactcaaa |
23536841 |
T |
|
| Q |
219 |
aa |
220 |
Q |
| |
|
|| |
|
|
| T |
23536840 |
aa |
23536839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University