View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5229_low_60 (Length: 228)
Name: NF5229_low_60
Description: NF5229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5229_low_60 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 1 - 194
Target Start/End: Original strand, 7010848 - 7011038
Alignment:
| Q |
1 |
cccaatcaacccccacaacaaacagttggacgtgacacatgtttgagttaaacaaaagggcagggacggagggagcttctcaacgctgtgctagctcaac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
7010848 |
cccaatcaacccccacaacaaacagttggacgtgacacatgtttgagttaaacgaaagggcagggacggagggagcttctcaacgctg---tagctcaac |
7010944 |
T |
|
| Q |
101 |
tccgcccttgccccgcttgtgtttgtatatgtgtcatactcaacacatttttgaatgatatgggcagtgtaggctacttctactcttctggtgt |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||| | | |||||||||||||||| |
|
|
| T |
7010945 |
tccgcccttgccccgcttgtgtttgtatatgtgtcatattcaacacttttttgaatgatatgggcagtgtaggttccgtctactcttctggtgt |
7011038 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 103
Target Start/End: Original strand, 42860072 - 42860174
Alignment:
| Q |
1 |
cccaatcaacccccacaacaaacagttggacgtgacacatgtttgagttaaacaaaagggcagggacggagggagcttctcaacgctgtgctagctcaac |
100 |
Q |
| |
|
|||| ||| |||||||||||||||| ||| | | || ||||| |||| ||||| ||||||| | ||||||||||||| ||||| || ||||||||| | |
|
|
| T |
42860072 |
cccagtcaccccccacaacaaacagctgggcctaactcatgtctgagccaaacataagggcaaaggcggagggagcttcacaacgttgcgctagctcagc |
42860171 |
T |
|
| Q |
101 |
tcc |
103 |
Q |
| |
|
||| |
|
|
| T |
42860172 |
tcc |
42860174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University