View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5229_low_61 (Length: 226)
Name: NF5229_low_61
Description: NF5229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5229_low_61 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 1 - 203
Target Start/End: Original strand, 28321880 - 28322091
Alignment:
| Q |
1 |
gcttacagattgttgtttcctaagaca---------acaatatgctaatgggatactcaaacgtaaactggtgctcaaagaagcaacatgaagtagcttt |
91 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28321880 |
gcttacagattgttgtttcctaagacatattttggaacaatatgctgatgggatactcaaacgtaaactggtgctcaaagaagcaacatgaagtagcttt |
28321979 |
T |
|
| Q |
92 |
gtcatcttgtgaggctgaaaacataacgtgcagcatgctaacctttgtagatagacccattcttgaaggacatgaaaattgaagttcataaacttttgca |
191 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||||| ||| |||||| |||||||||| ||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
28321980 |
gtcatcttgtgaggttgaaaacataaaatgcagcatgttaagctttgtggatagacccactcttgaaggacatgaaaattgaagtgcataaatctttgca |
28322079 |
T |
|
| Q |
192 |
agtgcatattga |
203 |
Q |
| |
|
| |||||||||| |
|
|
| T |
28322080 |
actgcatattga |
28322091 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University