View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5230-Insertion-6 (Length: 283)
Name: NF5230-Insertion-6
Description: NF5230
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5230-Insertion-6 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 7 - 283
Target Start/End: Original strand, 4328086 - 4328362
Alignment:
| Q |
7 |
acctcccttatccatagtcccaacacgatgtagcattgatggtggtgatgctcacaatccttcacaacgacaccacctctaaacccctcttgaggtagca |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4328086 |
acctcccttatccatagtcccaacacgatgtagcattgatggtggtgatgctcacaatccttcacaacgacaccacctctaaacccctcttgaggtagca |
4328185 |
T |
 |
| Q |
107 |
aaccctgggaatttctctggttgtttgatagatatgggttttggtttggatcgtgttttattcgtcgtagtcaatttgaatctcttagatcttggtttct |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
4328186 |
aaccctgggaatttctctggttgtttgatagatatgggttttggtttggatcgtgttttattcgtcgtagtcaatttgagtctcttagatcttggtttct |
4328285 |
T |
 |
| Q |
207 |
gctcaaaccttgcatgggctgcctaaatttccactagcaaattcatgtccccgacatgttctgtgttactattcgtc |
283 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4328286 |
gctcaaaccttgcatgggctgccaaaatttccactagcaaattcatgtccccgacatgttctgtgttactattcgtc |
4328362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University