View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5231_high_11 (Length: 348)
Name: NF5231_high_11
Description: NF5231
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5231_high_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 205 - 329
Target Start/End: Original strand, 32705181 - 32705305
Alignment:
| Q |
205 |
tcagtgtctatgattgaaataaggcgtggacctcttcttcagctagcatgcatcttttccctttcttgaataaattgttctatgcatggtctttgggaag |
304 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32705181 |
tcagtgtctatgattgaaacaaggcgtggacctcttcttcagctagcatgcatcttttccctttcttgaataaattgttctatgcatggtctttgggaag |
32705280 |
T |
|
| Q |
305 |
ccaattagttttgatcctcaagatt |
329 |
Q |
| |
|
|||||| |||||||||||||||||| |
|
|
| T |
32705281 |
ccaattcgttttgatcctcaagatt |
32705305 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 20 - 144
Target Start/End: Complemental strand, 32705305 - 32705181
Alignment:
| Q |
20 |
aatcttgaggatcaaaactaattggcttcccaaagaccatgcatagaacaatttattcaagaaagggaaaagatgcatgctagctgaagaagaggtccac |
119 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32705305 |
aatcttgaggatcaaaacgaattggcttcccaaagaccatgcatagaacaatttattcaagaaagggaaaagatgcatgctagctgaagaagaggtccac |
32705206 |
T |
|
| Q |
120 |
gccttatttcaatcatagacactga |
144 |
Q |
| |
|
||||| ||||||||||||||||||| |
|
|
| T |
32705205 |
gccttgtttcaatcatagacactga |
32705181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 159 - 187
Target Start/End: Complemental strand, 12279183 - 12279155
Alignment:
| Q |
159 |
accctaaccctaaccctaaccctaaccct |
187 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
12279183 |
accctaaccctaaccctaaccctaaccct |
12279155 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 160 - 188
Target Start/End: Original strand, 9491729 - 9491757
Alignment:
| Q |
160 |
ccctaaccctaaccctaaccctaacccta |
188 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
9491729 |
ccctaaccctaaccctaaccctaacccta |
9491757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University