View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5232_high_18 (Length: 277)
Name: NF5232_high_18
Description: NF5232
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5232_high_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 18 - 265
Target Start/End: Complemental strand, 42460743 - 42460494
Alignment:
| Q |
18 |
aaagtgaaggctactttggtagcagtgaacatgatgaatggtggcagtgtaactgagaaaatttgagagtagtggttttgtttaatttggagtgttnnnn |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42460743 |
aaagtgaaggctactttggtagcagtgaacatgatgaatggtggcagtgtaactgagaaaatttgagagtagtggttttgtttaatttggagtgttaaaa |
42460644 |
T |
|
| Q |
118 |
nnnnnnnnnnnnnntgaagagtagtagcttggagataaggcaatgagaacgtgtggagggaaatgcaacggcttattttcatatcgtcgtt--ttgttta |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
42460643 |
aaaatggaaaaaaatgaagagtagtagcttggagataaggcaatgagaacgtgtggagggaaatgcaacggcttattttcatatcgtcgtttcttgttta |
42460544 |
T |
|
| Q |
216 |
tatatcttcacacaagtcatcatatttcgttgcttatgtgtatgtgatga |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42460543 |
tatatcttcacacaagtcatcatatttcgttgcttatgtgtatgtgatga |
42460494 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University