View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5232_high_22 (Length: 251)

Name: NF5232_high_22
Description: NF5232
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5232_high_22
NF5232_high_22
[»] chr5 (1 HSPs)
chr5 (11-236)||(34035873-34036098)


Alignment Details
Target: chr5 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 11 - 236
Target Start/End: Original strand, 34035873 - 34036098
Alignment:
11 cacagaggcggaggaggaagcaacggtgtcttcgaccaaggaaactaagctaatttcgaagctaaacagtaaaattagcaccagagctatttcaatggtg 110  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34035873 cacagaggcggaggaggaagcaacggtgtcttcgaccaaggaaactaagctaatttcgaagctaaacagtaaaattagcaccagagctatttcaatggtg 34035972  T
111 aggatgctatcttggagaaaagtgcaggctgaaggagtattggaagaaggaaaccaagaagaagaagttctttggaggaagaacatcttgatgggagaaa 210  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34035973 aggatgctatcttggagaaaagtgcaggctgaaggaggattggaagaaggaaaccaagaagaagaagttctttggaggaagaacatcttgatgggagaaa 34036072  T
211 agtgtcgccctatggacgaggaaaat 236  Q
    |||||||||| |||||||| ||||||    
34036073 agtgtcgcccgatggacgacgaaaat 34036098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University