View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5232_low_13 (Length: 304)
Name: NF5232_low_13
Description: NF5232
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5232_low_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 57; Significance: 8e-24; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 196 - 300
Target Start/End: Complemental strand, 29822715 - 29822610
Alignment:
| Q |
196 |
tggaatgtagttggggggtaaagcgtggcaataccataatcatccnnnnnnnnnnn-ggagatagatatgtgacctcaggatgatcagttagttgagttt |
294 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29822715 |
tggaatgtaggtgggggataaagcgtggcaataccataatcatccaaaaaaaaaaaaggagatagatatgtgacctcaggatgatcagttagttgagttt |
29822616 |
T |
|
| Q |
295 |
cacctt |
300 |
Q |
| |
|
|||||| |
|
|
| T |
29822615 |
cacctt |
29822610 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 12 - 62
Target Start/End: Complemental strand, 29822971 - 29822920
Alignment:
| Q |
12 |
atgaactcaattgtgccacataagttctatatcattaaaa-aggtagaggtc |
62 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
29822971 |
atgaactcaattgtgccacataaattctatatcattaaaagaggtagaggtc |
29822920 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University