View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5232_low_20 (Length: 255)
Name: NF5232_low_20
Description: NF5232
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5232_low_20 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 13 - 228
Target Start/End: Original strand, 29822283 - 29822498
Alignment:
| Q |
13 |
aaaatcacctcataaccaaatatgtttttcataggagagaaaaagggtacctaatttgaggagaagtagatggtttattggaagcagaacaaacaatagt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29822283 |
aaaatcacctcataaccaaatatgtttttcataggagagaaaaagggtacctaatttgaggagaagtagatggtttattggaagcagaacaaacaatagt |
29822382 |
T |
|
| Q |
113 |
gggaacagaagatctttggtgagaatagtaaagagtgtgagtgtgaccataactgagtcttgaggaacttaacataaaattggtacgatgattgtggatg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
29822383 |
gggaacagaagatctttggtgagaatagtaaagagtgtgagtgtgaccataactgagtcttgaggaactgaacataaaattggtacgatgattgtggatg |
29822482 |
T |
|
| Q |
213 |
aaacatggtggtggtg |
228 |
Q |
| |
|
|||||||| ||||||| |
|
|
| T |
29822483 |
aaacatggaggtggtg |
29822498 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University