View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5232_low_22 (Length: 251)
Name: NF5232_low_22
Description: NF5232
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5232_low_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 11 - 236
Target Start/End: Original strand, 34035873 - 34036098
Alignment:
| Q |
11 |
cacagaggcggaggaggaagcaacggtgtcttcgaccaaggaaactaagctaatttcgaagctaaacagtaaaattagcaccagagctatttcaatggtg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34035873 |
cacagaggcggaggaggaagcaacggtgtcttcgaccaaggaaactaagctaatttcgaagctaaacagtaaaattagcaccagagctatttcaatggtg |
34035972 |
T |
 |
| Q |
111 |
aggatgctatcttggagaaaagtgcaggctgaaggagtattggaagaaggaaaccaagaagaagaagttctttggaggaagaacatcttgatgggagaaa |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34035973 |
aggatgctatcttggagaaaagtgcaggctgaaggaggattggaagaaggaaaccaagaagaagaagttctttggaggaagaacatcttgatgggagaaa |
34036072 |
T |
 |
| Q |
211 |
agtgtcgccctatggacgaggaaaat |
236 |
Q |
| |
|
|||||||||| |||||||| |||||| |
|
|
| T |
34036073 |
agtgtcgcccgatggacgacgaaaat |
34036098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University