View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5232_low_24 (Length: 250)
Name: NF5232_low_24
Description: NF5232
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5232_low_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 56298735 - 56298498
Alignment:
| Q |
1 |
cattcgatcgagtagtgatttaatcatttccttgtata------ttaatcatcaatatcttatctaatttgcagacaaatttttagattactcttcaatc |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
56298735 |
cattcgatcgagtagtgatttaatcatttccttatataatagtattaatcatcaatatcttatctaatttgcagacaaatttttagattactcttcactc |
56298636 |
T |
 |
| Q |
95 |
tttgtaaattttgcnnnnnnnncataagatgagttgaaaatttagcatgcacgatatactctttaaaaacaaattaaaggatttgaatcaattaaattaa |
194 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
56298635 |
tttgtaaattttgcaaaaaaaacataagatgagttgaaaatttagcatgcacgatatactctttaaaaacaaattaaaggatttgaataaattaaattaa |
56298536 |
T |
 |
| Q |
195 |
ttcaagataatgggaaataagacaacgtcttgatgcta |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56298535 |
ttcaagataatgggaaataagacaacgtcttgatgcta |
56298498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University