View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5233-Insertion-13 (Length: 313)
Name: NF5233-Insertion-13
Description: NF5233
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5233-Insertion-13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 168; Significance: 5e-90; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 168; E-Value: 5e-90
Query Start/End: Original strand, 7 - 225
Target Start/End: Original strand, 12882100 - 12882319
Alignment:
| Q |
7 |
agaaacatgttggtggaccaagaacaagtacttttggaagctctttggccattgaattttaaggatttgtggtgtttgagaaagggatgaaattagcact |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
12882100 |
agaaacatgttggtggaccaagaacaagtacttttggaaggtctttggccattgaattttaaggatttgtggtgtttgagaaagggatgaacttagcact |
12882199 |
T |
|
| Q |
107 |
ctcatttggatgacactcaaaactgtggctagaaactcctcttaatta-ttctctgtatcacttgtcttccatgaagcaccaacacgtcttagattagaa |
205 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||| | |||| | ||||||||||| |
|
|
| T |
12882200 |
tttatttggatgacactcaaaactgtggctagaaactcctcttaattatttctctgtatcacttgacttccatgaagcgcgaacatgccttagattagac |
12882299 |
T |
|
| Q |
206 |
gtattccggtgtcggataca |
225 |
Q |
| |
|
||||| |||||||||||||| |
|
|
| T |
12882300 |
gtatttcggtgtcggataca |
12882319 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University