View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5233-Insertion-15 (Length: 264)
Name: NF5233-Insertion-15
Description: NF5233
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5233-Insertion-15 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 12 - 264
Target Start/End: Complemental strand, 54972651 - 54972399
Alignment:
| Q |
12 |
caccctgtcaaaattttgttttcatgatgaaggcttttgctataatactatttacttgttaataacttggtcaaggaaatgaaaaacgtaaatggtgtaa |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
54972651 |
caccctgtcaaaattttgttttcatgatgaaggcttttgatataatactatttacttgttaataacttggtcaaggaaatgaaaaacgtaaatggtgcaa |
54972552 |
T |
|
| Q |
112 |
taaagtagtctatactaatgctatcatgcacttcaatttccataatgtaagcagctacatattaagttggttatggtttcctatactaggttccaattgg |
211 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54972551 |
taaagtagtctatgctaatgctatcatgcacttcaatttccataatgtaagcagctacatattaagttggttatggtttcctatactaggttccaattgg |
54972452 |
T |
|
| Q |
212 |
aggcgcttataggctgattgatgtgccaatgagtaactgcatcaatagtggga |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54972451 |
aggcgcttataggctgattgatgtgccaatgagtaactgcatcaatagtggga |
54972399 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University