View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5233-Insertion-4 (Length: 158)
Name: NF5233-Insertion-4
Description: NF5233
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5233-Insertion-4 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 103; Significance: 1e-51; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 103; E-Value: 1e-51
Query Start/End: Original strand, 8 - 158
Target Start/End: Complemental strand, 4960547 - 4960398
Alignment:
| Q |
8 |
ttagagcctgccaattctcccacttcttttttgagattccctctctatttttataatgacatatttataataatataatagttatagnnnnnnnntccac |
107 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| | ||||| |
|
|
| T |
4960547 |
ttagagcctgccaattctcacacttcttttttgagattccttctctatttttataatgacatatttataataatataatagttat-gaaaaaaaatccac |
4960449 |
T |
|
| Q |
108 |
cactaaacaacactcagaagcataaacaaacacgtaagttcccttcatttc |
158 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
4960448 |
cactaaacaacactcagaagcataaacagacatgtaagttcccttcatttc |
4960398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 43; Significance: 9e-16; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 43; E-Value: 9e-16
Query Start/End: Original strand, 8 - 93
Target Start/End: Complemental strand, 22475568 - 22475482
Alignment:
| Q |
8 |
ttagagcctgccaattctcccacttctttttt-gagattccctctctatttttataatgacatatttataataatataatagttata |
93 |
Q |
| |
|
||||| || ||||||||||||||||||||||| ||||||||||||| ||||| || || ||||| |||||||||| |||||| |||| |
|
|
| T |
22475568 |
ttagaccccgccaattctcccacttctttttttgagattccctctcaattttcattataacataattataataatttaataggtata |
22475482 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University