View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5233-Insertion-7 (Length: 65)
Name: NF5233-Insertion-7
Description: NF5233
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5233-Insertion-7 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 52; Significance: 1e-21; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 52; E-Value: 1e-21
Query Start/End: Original strand, 10 - 65
Target Start/End: Original strand, 19397772 - 19397827
Alignment:
| Q |
10 |
tatcatactactactaacactacaacacattacatttcataatttactttacattt |
65 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19397772 |
tatcctactactactaacactacaacacattacatttcataatttactttacattt |
19397827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University