View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5233_high_8 (Length: 458)
Name: NF5233_high_8
Description: NF5233
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5233_high_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 189 - 442
Target Start/End: Original strand, 21257965 - 21258216
Alignment:
| Q |
189 |
aagcacaaattaagcaaggtgaggaagaagaagattaacccatgaataaaatcaacatgatgacaagggagaaagaaaaactcattaagattaagaatat |
288 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21257965 |
aagcacaaattaagcaaggtgag-aagaagaagattaacccatgaataaaatcaacatgacgacaagggagaaagaaaaactcattaagattaagaatat |
21258063 |
T |
 |
| Q |
289 |
gaaagggggagatgaaaagtttgagggatggatgggtagttggcagtttagcttgcatttaaggttagcttaggagggaaaacttaagttgattagggtt |
388 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
21258064 |
gaaagggagagatgaaaagtttgagggatggataggtagttggcagtttagcttgcatttaaggttagcttaggagggaaaac-taagttgattagggtt |
21258162 |
T |
 |
| Q |
389 |
tagtgccagcttggcaagttaagcttttataataagggaagagatgttacccct |
442 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21258163 |
tagtgccagcttggcaagttaagcttttataataagggaagagatgttacccct |
21258216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 46; Significance: 5e-17; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 347 - 404
Target Start/End: Original strand, 21555005 - 21555062
Alignment:
| Q |
347 |
ttaaggttagcttaggagggaaaacttaagttgattagggtttagtgccagcttggca |
404 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
21555005 |
ttaatgttagcttaggagggaaaacttaaggtgattagggtttactgccagcttggca |
21555062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University